View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0812_high_133 (Length: 240)

Name: NF0812_high_133
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0812_high_133
NF0812_high_133
[»] chr3 (1 HSPs)
chr3 (37-161)||(43606437-43606560)


Alignment Details
Target: chr3 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 37 - 161
Target Start/End: Original strand, 43606437 - 43606560
Alignment:
37 atggttgataaaactatgtattatttcactcgaaatagtttatgtagttttattggttcaagtcaatttaaacctctaataattgctaattgaatcagaa 136  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| |||||||||||||| |||||    
43606437 atggttgataaaactatgtattatttcactcgaaatagtttatgtagttttattggttcaagtcaatttaaa-ctttaacaattgctaattgaaacagaa 43606535  T
137 cgagcccctaacttcctctaatatt 161  Q
    |||||||||||||||||||||||||    
43606536 cgagcccctaacttcctctaatatt 43606560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 6243 times since January 2019
Visitors: 5764