View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0812_high_140 (Length: 229)
Name: NF0812_high_140
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0812_high_140 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 47928800 - 47928577
Alignment:
Q |
1 |
cagtatgtctctaacttcgtattataattcatttgtgattagtgttatgattatgatctaatattatgtatgtaatttgtgtcactttcagttgggaaag |
100 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47928800 |
cagtatgtctctaactttgtattataattcatttgtgatcagtgttatgattatgatctaatattatgtatgtaatttgtgtcactttcagttgggaaag |
47928701 |
T |
 |
Q |
101 |
agatcgtggatctgtgtttggaccgtatcagaaagcttgctgataactgcactggtctccaagggtttttggttttcaatgctgttggaggaggaactgg |
200 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
47928700 |
agatcgtggatctgtgtttggaccgcatcagaaagcttgctgataactgcactggtctccaagggtttttggtttttaatgctgttggaggaggaactgg |
47928601 |
T |
 |
Q |
201 |
ttctggtcttggttctctgctcct |
224 |
Q |
|
|
|||||||||||||||||||||||| |
|
|
T |
47928600 |
ttctggtcttggttctctgctcct |
47928577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 87 - 215
Target Start/End: Complemental strand, 40378147 - 40378019
Alignment:
Q |
87 |
ttcagttgggaaagagatcgtggatctgtgtttggaccgtatcagaaagcttgctgataactgcactggtctccaagggtttttggttttcaatgctgtt |
186 |
Q |
|
|
||||||||| ||||| || || ||| | || |||||||| |||||||||||||| || |||||||||||||||||||| ||| |||||||||||||||| |
|
|
T |
40378147 |
ttcagttggaaaagaaattgttgatgtatgcttggaccgcatcagaaagcttgcagacaactgcactggtctccaaggctttctggttttcaatgctgta |
40378048 |
T |
 |
Q |
187 |
ggaggaggaactggttctggtcttggttc |
215 |
Q |
|
|
|| ||||| |||||||| ||||||||||| |
|
|
T |
40378047 |
ggtggaggcactggttccggtcttggttc |
40378019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 109 - 215
Target Start/End: Complemental strand, 35670236 - 35670130
Alignment:
Q |
109 |
gatctgtgtttggaccgtatcagaaagcttgctgataactgcactggtctccaagggtttttggttttcaatgctgttggaggaggaactggttctggtc |
208 |
Q |
|
|
|||||||||||||| ||| | || || | ||||||||||| || ||||| |||||||||||||||||||| || ||||| || ||||| |||||||||| |
|
|
T |
35670236 |
gatctgtgtttggatcgtgttaggaaattggctgataactgtaccggtcttcaagggtttttggttttcaacgccgttggtggtggaaccggttctggtc |
35670137 |
T |
 |
Q |
209 |
ttggttc |
215 |
Q |
|
|
| ||||| |
|
|
T |
35670136 |
tgggttc |
35670130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 87 - 218
Target Start/End: Complemental strand, 51752625 - 51752494
Alignment:
Q |
87 |
ttcagttgggaaagagatcgtggatctgtgtttggaccgtatcagaaagcttgctgataactgcactggtctccaagggtttttggttttcaatgctgtt |
186 |
Q |
|
|
|||||||||||| ||||| || ||||| || | ||| | ||| ||||||| || |||||||| |||||||| ||||| || ||||| ||||||||||| |
|
|
T |
51752625 |
ttcagttgggaaggagattgttgatctatgcctcgacaggatccgaaagctagcagataactgtactggtctgcaaggtttcttggtgttcaatgctgtg |
51752526 |
T |
 |
Q |
187 |
ggaggaggaactggttctggtcttggttctct |
218 |
Q |
|
|
|| || ||||| || |||||| | |||||||| |
|
|
T |
51752525 |
ggtggtggaaccggatctggtttgggttctct |
51752494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 139 - 207
Target Start/End: Complemental strand, 10032912 - 10032844
Alignment:
Q |
139 |
gctgataactgcactggtctccaagggtttttggttttcaatgctgttggaggaggaactggttctggt |
207 |
Q |
|
|
||||| || |||||||| | ||||| ||||||||||| ||||||||||| || ||||||||||||||| |
|
|
T |
10032912 |
gctgaaaattgcactggcttgcaaggatttttggtttttaatgctgttggcggtggaactggttctggt |
10032844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6165 times since January 2019
Visitors: 5762