View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0812_high_141 (Length: 225)

Name: NF0812_high_141
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0812_high_141
NF0812_high_141
[»] chr7 (1 HSPs)
chr7 (6-180)||(22606419-22606593)


Alignment Details
Target: chr7 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 6 - 180
Target Start/End: Original strand, 22606419 - 22606593
Alignment:
6 atgtcgaataatatataaatgtgaagactcataaagctaatgccttaagatagcgagctctcatatagttttggattcctaaattatgatgacaattatc 105  Q
    |||| ||| ||||||||||||||||||||| ||| |||||||||||||||||  |||||||||||||||||||||||| |||||||||||||||||||||    
22606419 atgtggaacaatatataaatgtgaagactcgtaaggctaatgccttaagataatgagctctcatatagttttggattcgtaaattatgatgacaattatc 22606518  T
106 taatatttaaatagatggaagcaataaatggattaaatttggaagtttataaccaaagtttgataattgtttaaa 180  Q
    | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22606519 tgatatttaaatagatggaagcaataaatggattaaatttggaagtttataaccaaagtttgataattgtttaaa 22606593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University