View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0812_high_143 (Length: 221)
Name: NF0812_high_143
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0812_high_143 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 6e-95; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 9619032 - 9618841
Alignment:
| Q |
1 |
ataaaaaccattaacactatctacggacgtgacaaacaattacctttgaaatggtaaaatcttgaagtttgggacaactttggagcattttcattacatc |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
9619032 |
ataaaagccattaacactatctacggacgtgacaaacaattaccttcgaaatggtaaaatcttgaggtttgggacaactttggagcattttcattacatc |
9618933 |
T |
|
| Q |
101 |
atcccagtcaaaaaggacatgaaaaatccaatatagtcgaagtacggttaagttttcaaacacgggaatgtcaatgtaatatgaattgattt |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9618932 |
atcccagtcaaaaaggacatgaaaaatccaatatagtcgaagtactgttaagttttcaaacacgggaatgtcaatgtaatatgaattgattt |
9618841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 66 - 106
Target Start/End: Complemental strand, 19806937 - 19806897
Alignment:
| Q |
66 |
agtttgggacaactttggagcattttcattacatcatccca |
106 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||| |||||||| |
|
|
| T |
19806937 |
agtttgggacaattttggagcattttcactacctcatccca |
19806897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5098 times since January 2019
Visitors: 5754