View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0812_high_145 (Length: 207)

Name: NF0812_high_145
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0812_high_145
NF0812_high_145
[»] chr5 (2 HSPs)
chr5 (1-82)||(7901082-7901163)
chr5 (101-130)||(7901184-7901213)


Alignment Details
Target: chr5 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 1 - 82
Target Start/End: Original strand, 7901082 - 7901163
Alignment:
1 ctaccaaattaacctagctcactttttatccttcatgcaacaaactgatagatcattttaccttctcattacaagtattcaa 82  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||    
7901082 ctaccaaattaacctagctcactttttatccttcatgcaacaaactgatagatcatttcaccttctcaatacaagtattcaa 7901163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 101 - 130
Target Start/End: Original strand, 7901184 - 7901213
Alignment:
101 gtatatatatgtgcaccacaatgtatctgt 130  Q
    ||||||||||||||||||||||||||||||    
7901184 gtatatatatgtgcaccacaatgtatctgt 7901213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University