View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0812_high_21 (Length: 528)
Name: NF0812_high_21
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0812_high_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 388; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 388; E-Value: 0
Query Start/End: Original strand, 16 - 499
Target Start/End: Original strand, 4569770 - 4570247
Alignment:
Q |
16 |
atgggaagatgggtcgtcgtcgaggtagtttacggattcgagagtgatgtctacggtggcgtgaatgagaggaacgctgtcttggcttttggagcagaag |
115 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
4569770 |
atgggaagatgggtcgtcgtcgaggtagtttacggattcgagagtgatgtctacggtggcgtggatgagaggaacgctgtcttggcttttggagcagaag |
4569869 |
T |
 |
Q |
116 |
agttcgaggcggtggttgtggtagcggagtgtggcggcgagtgggtagtaatgagggagagtttttgagagggaggaggagatgacggtgaagggatcan |
215 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4569870 |
agttcgaggcggtggttgtggtagcggagtgtggcggcgagtgggtagtaatgagggagagtttttgagagggaggaggagatgacggtgaagggatcat |
4569969 |
T |
 |
Q |
216 |
nnnnnnnnnnnnnnnnnnctgtgtaagcgcggaggtagcgtatggttgtattgaggttgcggtcggtgtcgaggtgggagagagggagggtgtggtcttc |
315 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
4569970 |
ggtggtgggtggtggtggctgtgtaagcgcggaggtagcgtatggttgtattgaggttgcggtcgatgtcgaggtgggagagagggagggtgtggtcttc |
4570069 |
T |
 |
Q |
316 |
aaggaagggggtgtgagaaggaaaaatgagaatttgttctttaattttcaacattttaaatttaattgtatggtttgtgttatgttgtgaggttattttt |
415 |
Q |
|
|
||||||||||||||||||||||||||||||| |||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4570070 |
aaggaagggggtgtgagaaggaaaaatgagagtttgttctttgattttcaacat------tttaattgtatggtttgtgttatgttgtgaggttattttt |
4570163 |
T |
 |
Q |
416 |
gcttaatgctacctgattgctttgctttgtctgtgttttcagcgttggagatttgagtcactttctcccaccaaacccatagag |
499 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4570164 |
gcttaatgctacctgattgctttgctttgtctgtgttttcagcgttggagatttgagtcactttctcccaccaaacccatagag |
4570247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6588 times since January 2019
Visitors: 5769