View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0812_high_45 (Length: 425)
Name: NF0812_high_45
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0812_high_45 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 11 - 346
Target Start/End: Complemental strand, 217517 - 217187
Alignment:
| Q |
11 |
atgaagttagttactactgaaaacaatgcatgatttataaccatgtatctagtttatgggaaaatgaaatcatgtgaaaagtagcaaacctagatagcat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
217517 |
atgaagttagttactactgaaaacaatgcatgatttataaccatgtatctagtttatgggaaaatgaaatcatgtgaaaagtagcaaacctagatagcat |
217418 |
T |
 |
| Q |
111 |
gcatatgcaatagatattgcatagagaagggattatttgggttagggtgaaagggtgatggagttacttagggaaggtttcatctttgtacttgacacca |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
217417 |
gcatatgcaatagatattgcatagagaagggattatttgggttagggtgaaagggtgatggagttacttaggggaggtttcatctttgtacttgacacca |
217318 |
T |
 |
| Q |
211 |
ttccacgtgtatgtcattgtgtgcatgtcaaattgggtaatatggcaatatttatggtggataacactatgtcattgtattgtattgcttattgtcatgg |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
217317 |
ttccacgtgtatgtcattgtgtgcatgtcaaattgggtaatatagcaatatttatggtggataacactatgtcattgt-----attgcttattgtcatgg |
217223 |
T |
 |
| Q |
311 |
ttttataagctttggttagtccatggtacaacttct |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
217222 |
ttttataagctttggttagtccatggtacaacttct |
217187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University