View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0812_high_55 (Length: 387)
Name: NF0812_high_55
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0812_high_55 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 6e-90; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 6e-90
Query Start/End: Original strand, 29 - 220
Target Start/End: Original strand, 56071 - 56262
Alignment:
| Q |
29 |
attttcatggttacatccctcaaacatatcaatttaacaatcatacctaaattacccctaacctgatatttgatcattgacttttgtttatagagaaaat |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
56071 |
attttcatggttacatccctcaaacatatcaatttaacaatcatacctaaattacccctaacctgatatttgatcaatgacttttgtttatagagaaaat |
56170 |
T |
 |
| Q |
129 |
ttgtttggtcggtaggcaagaacttacctcatgtgcctgatgaatgccccgattaatatcagttatgttaaatgatggtgaaaacttcattt |
220 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||||| || |||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
56171 |
ttgtttggttggtaggcgagaacttacctcatgtgcctgatgaattcctcgattaatattagttatgttaaatgatggtgaaaacttcattt |
56262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 285 - 375
Target Start/End: Original strand, 56334 - 56424
Alignment:
| Q |
285 |
gaattgaattttcagcttcatcctggttgtcttcaatttaattcctacacccttaactttgagtgaggtttattttaaaccatatcagtat |
375 |
Q |
| |
|
||||||||||||||||||||| | |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56334 |
gaattgaattttcagcttcattcaggttgtcttcgatttaattcctacacccttaactttgagtgaggtttattttaaaccatatcagtat |
56424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University