View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0812_high_58 (Length: 381)
Name: NF0812_high_58
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0812_high_58 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-124; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 152 - 381
Target Start/End: Original strand, 40231375 - 40231604
Alignment:
| Q |
152 |
caatagtagattcatagttttcctaaatgaaatgattggttcagatgtattggtgtgtgtcaatgtcttgtattggtttatttgtgaaatagaacttttt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40231375 |
caatagtagattcatagttttcctaaatgaaatgattggttcagatgtattggtgtgtgtcaatgtcttgtgttggtttatttgtgaaatagaacttttt |
40231474 |
T |
|
| Q |
252 |
gtagctcttcactgcaaatttactgtaactgtaacttagaacaaggcttgcttctaatttgtaatttagaaccctcagattaattttgtttattaactct |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40231475 |
gtagctcttcactgcaaatttactgtaactgtaacttagaacaaggcttgcttctaatttgtaatttagaaccctcagattaattttgtttattaactct |
40231574 |
T |
|
| Q |
352 |
gtttcatcttcactgcaaatttactgatga |
381 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40231575 |
gtttcatcttcactgcaaatttactgatga |
40231604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 33 - 92
Target Start/End: Original strand, 40231276 - 40231335
Alignment:
| Q |
33 |
cataaccctctcctcagtcaatgccgctctctttctcatctctgttaaccatactttgtc |
92 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40231276 |
cataaccctctcctcagtcaacgccgctctctttctcatctctgttagccatactttgtc |
40231335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 54; Significance: 6e-22; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 179 - 248
Target Start/End: Original strand, 24653121 - 24653190
Alignment:
| Q |
179 |
tgaaatgattggttcagatgtattggtgtgtgtcaatgtcttgtattggtttatttgtgaaatagaactt |
248 |
Q |
| |
|
|||||||||||||| || ||||||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24653121 |
tgaaatgattggttaagctgtattggtgtgtgttaatgtcttgtattggttcatttgtgaaatagaactt |
24653190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 307 - 374
Target Start/End: Original strand, 24679343 - 24679410
Alignment:
| Q |
307 |
aatttgtaatttagaaccctcagattaattttgtttattaactctgtttcatcttcactgcaaattta |
374 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| || ||||||| |
|
|
| T |
24679343 |
aatttgtaatttagaaccctaagattaattttgtttattaactctgtttcatcgtcattgtaaattta |
24679410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 170 - 247
Target Start/End: Original strand, 24679210 - 24679287
Alignment:
| Q |
170 |
tttcctaaatgaaatgattggttcagatgtattggtgtgtgtcaatgtcttgtattggtttatttgtgaaatagaact |
247 |
Q |
| |
|
||||| || |||||||||||||| || ||||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
24679210 |
tttccgaactgaaatgattggttaagctgtattggtgtgtgttaatgtcttgtattggtacatttgtgaaatagaact |
24679287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 162 - 226
Target Start/End: Original strand, 19899573 - 19899637
Alignment:
| Q |
162 |
ttcatagttttcctaaatgaaatgattggttcagatgtattggtgtgtgtcaatgtcttgtattg |
226 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||| | || || | ||||| |||||||||||||| |
|
|
| T |
19899573 |
ttcataattttcctaaatgaaacgattggttcagctttagtgatttgtgttaatgtcttgtattg |
19899637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5859 times since January 2019
Visitors: 5760