View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0812_high_83 (Length: 322)
Name: NF0812_high_83
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0812_high_83 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 9e-67; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 9e-67
Query Start/End: Original strand, 66 - 253
Target Start/End: Original strand, 28654744 - 28654934
Alignment:
| Q |
66 |
ggagcagagatcagtgagaagttttgggatgagaaacttcaagtatgtgaacaccatcaaagctgctgtcgagaaagaatgtcccttgacagtgtcatgt |
165 |
Q |
| |
|
|||||||| ||| || |||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28654744 |
ggagcagacatcggtaagaagttttgggatgagaaatttcaagtatgtgaacaccatcaaagctgctgttgagaaagaatgtcccttgacagtgtcatgt |
28654843 |
T |
 |
| Q |
166 |
gctgacattgtcgctctttctgcgagagacggtattgcaatggtatgtttatg---tcatcttatacacatgctaggagtcgcctctcgga |
253 |
Q |
| |
|
||||| ||||| ||||||||||| |||||||||||||||||||||||| |||| ||||| |||||||||| ||||||| |||||||||| |
|
|
| T |
28654844 |
gctgatattgttgctctttctgctagagacggtattgcaatggtatgtctatgtcatcatcatatacacatgttaggagttgcctctcgga |
28654934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 66 - 233
Target Start/End: Original strand, 28635463 - 28635630
Alignment:
| Q |
66 |
ggagcagagatcagtgagaagttttgggatgagaaacttcaagtatgtgaacaccatcaaagctgctgtcgagaaagaatgtcccttgacagtgtcatgt |
165 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
28635463 |
ggagcagacatcggtgagaagttttgggatgagaaatttcaagtatgtgaataccatcaaagcagctgtcgagaaagaatgtcccttgacagtgtcatgc |
28635562 |
T |
 |
| Q |
166 |
gctgacattgtcgctctttctgcgagagacggtattgcaatggtatgtttatgtcatcttatacacat |
233 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
28635563 |
gctgacattgtcgctctatctgctagagacggtattgcaatggtatgtctatgtcatcatatacacat |
28635630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 81 - 213
Target Start/End: Original strand, 28605310 - 28605442
Alignment:
| Q |
81 |
gagaagttttgggatgagaaacttcaagtatgtgaacaccatcaaagctgctgtcgagaaagaatgtcccttgacagtgtcatgtgctgacattgtcgct |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||| | || ||||||||||| |||||||||||||| ||||||||||| ||| |
|
|
| T |
28605310 |
gagaagttttgggatgagaaacttcaagtatgtgagcaccatcaaagctgctcttgaaaaagaatgtcctttgacagtgtcatgcgctgacattgttgct |
28605409 |
T |
 |
| Q |
181 |
ctttctgcgagagacggtattgcaatggtatgt |
213 |
Q |
| |
|
|||||||| |||||||||||||| | ||||||| |
|
|
| T |
28605410 |
ctttctgctagagacggtattgccagggtatgt |
28605442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 70 - 214
Target Start/End: Original strand, 28663150 - 28663294
Alignment:
| Q |
70 |
cagagatcagtgagaagttttgggatgagaaacttcaagtatgtgaacaccatcaaagctgctgtcgagaaagaatgtcccttgacagtgtcatgtgctg |
169 |
Q |
| |
|
|||| ||||| |||||||| |||||| |||||||||||||||| || ||||||||||||||||| ||||||||||||||||||||||| |||||||| | |
|
|
| T |
28663150 |
cagacatcagagagaagttccgggatgcgaaacttcaagtatgtaaaaaccatcaaagctgctgtggagaaagaatgtcccttgacagtatcatgtgccg |
28663249 |
T |
 |
| Q |
170 |
acattgtcgctctttctgcgagagacggtattgcaatggtatgtt |
214 |
Q |
| |
|
||||||| |||||||| || |||||||| ||||| |||||||||| |
|
|
| T |
28663250 |
acattgttgctctttccgctagagacggaattgccatggtatgtt |
28663294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University