View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0812_high_85 (Length: 315)
Name: NF0812_high_85
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0812_high_85 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 94 - 315
Target Start/End: Original strand, 44001238 - 44001463
Alignment:
Q |
94 |
aaactaacaatactaaagtcactactagtaatgtactaaatcacaaagccagtttattcttccagcaacaagg----tatcatgattcaattagaacgag |
189 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
44001238 |
aaactaacaatactaaagtcactactagtaatgtactaaatcacaaagccagtttattcttccagcaacaaggaaggtatcatgattcaattagaacgag |
44001337 |
T |
 |
Q |
190 |
attggtatggcttgatcaattgagtgagtgagccacttaggtgaagggacataatttcattggtggaccccatcagttgccctccaatgaacacagcagg |
289 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44001338 |
attggtatggcttgatcaattgagtgagtgagccacttaggtgaagggacataatttcattggtggaccccatcagttgccctccaatgaacacagcagg |
44001437 |
T |
 |
Q |
290 |
aacaggagcagtacaacctaacctca |
315 |
Q |
|
|
|||||| ||||||||||||||||||| |
|
|
T |
44001438 |
aacaggtgcagtacaacctaacctca |
44001463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 215 - 307
Target Start/End: Complemental strand, 39866204 - 39866112
Alignment:
Q |
215 |
gagtgagccacttaggtgaagggacataatttcattggtggaccccatcagttgccctccaatgaacacagcaggaacaggagcagtacaacc |
307 |
Q |
|
|
|||||| ||||||||||| |||||||| | ||||||||||||||||| || ||||||||||| || ||||| ||||| ||| ||||||| |
|
|
T |
39866204 |
gagtgaaccacttaggtgtagggacattacttcattggtggaccccacaagccttcctccaatgaatactgcagggacaggtgcattacaacc |
39866112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 216 - 307
Target Start/End: Complemental strand, 39861749 - 39861658
Alignment:
Q |
216 |
agtgagccacttaggtgaagggacataatttcattggtggaccccatcagttgccctccaatgaacacagcaggaacaggagcagtacaacc |
307 |
Q |
|
|
||||| ||||||||||| |||||||| | ||||||||||||||||| || ||||||||||| || ||||| ||||| ||| ||||||| |
|
|
T |
39861749 |
agtgaaccacttaggtgtagggacattacttcattggtggaccccacaagccttcctccaatgaatactgcagggacaggtgcattacaacc |
39861658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University