View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0812_high_94 (Length: 306)
Name: NF0812_high_94
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0812_high_94 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 86; Significance: 4e-41; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 81 - 182
Target Start/End: Complemental strand, 4521030 - 4520929
Alignment:
| Q |
81 |
tggagggtgaaggagttgattcgtcatctcactcaattgttgcttattcttgatgtagatatttgagggacaagattttctcattaattcattagttttt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4521030 |
tggagggtgaaggagttgattcgtcatctctctcaattgtagcttattcttgatgtagatattcgagggacaagattttctgattaattcattagttttt |
4520931 |
T |
|
| Q |
181 |
ct |
182 |
Q |
| |
|
|| |
|
|
| T |
4520930 |
ct |
4520929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6702 times since January 2019
Visitors: 5770