View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0812_high_95 (Length: 304)
Name: NF0812_high_95
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0812_high_95 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 43 - 294
Target Start/End: Complemental strand, 39954361 - 39954110
Alignment:
| Q |
43 |
agctatcatacccacgatcatcatcaaaactcaccaacttctctggttgagaatgcttaagtgaagcagaaggggtgagcaggcgaattccggattcagg |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39954361 |
agctatcatacccacgatcatcatcaaaactcaccaacttctctggttgagaatgcttaagtgaagcagaaggggtgagcaggcgaattccggattcagg |
39954262 |
T |
 |
| Q |
143 |
cctgacttgatcaaaccgttctgctaacaagcggtgtttcctatagaaatcttcaaccatgctcacaagctctggcctcttcttgtaaaacatctcagct |
242 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39954261 |
cctgacttgatcaaaccgttcagctaacaagcggtgtttcctatagaaatcttcaaccatgctcacaagctctggcctcttcttgtaaaacatctcagct |
39954162 |
T |
 |
| Q |
243 |
ctttgtgcaaaggaatctgcatctccttcaattaatttcaacattgcctttg |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39954161 |
ctttgtgcaaaggaatctgcatctccttcaattaatttcaacattgcctttg |
39954110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 185 - 294
Target Start/End: Original strand, 43948528 - 43948637
Alignment:
| Q |
185 |
atagaaatcttcaaccatgctcacaagctctggcctcttcttgtaaaacatctcagctctttgtgcaaaggaatctgcatctccttcaattaatttcaac |
284 |
Q |
| |
|
||||||||||||||||||||| ||||| || || | |||||||||| ||||||| || | || ||||||||||||||||||| |||||||||| || ||| |
|
|
| T |
43948528 |
atagaaatcttcaaccatgctaacaagttcgggtcgcttcttgtaatacatctctgcacgttttgcaaaggaatctgcatcttcttcaattaactttaac |
43948627 |
T |
 |
| Q |
285 |
attgcctttg |
294 |
Q |
| |
|
||||| |||| |
|
|
| T |
43948628 |
attgcatttg |
43948637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University