View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0812_high_99 (Length: 297)
Name: NF0812_high_99
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0812_high_99 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 32 - 231
Target Start/End: Original strand, 3860469 - 3860669
Alignment:
| Q |
32 |
ataaattttactctatgatgcagacagattcatataaatcaacaggatgttttgatctcacttgctctggatttgtgcaaacatccaatacagttgctct |
131 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3860469 |
ataaattttactct--gatgcagacagattcatataaatcaacaggatgttttgatctcacttgctctggatttgtgcaaacatccaatacagttgctct |
3860566 |
T |
|
| Q |
132 |
tggtggtggcataaatcccatatcatctgactctggcacacaatatgaattaaatattggaatatacttggta---ataacaacattattttcttatatt |
228 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3860567 |
tggtggtggcataaaccccatatcatctgactctggcacacaatatgaattaaatattggaatatacttggtaattataacaacattattttcttatatt |
3860666 |
T |
|
| Q |
229 |
cat |
231 |
Q |
| |
|
||| |
|
|
| T |
3860667 |
cat |
3860669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 45 - 114
Target Start/End: Complemental strand, 47919478 - 47919409
Alignment:
| Q |
45 |
tatgatgcagacagattcatataaatcaacaggatgttttgatctcacttgctctggatttgtgcaaaca |
114 |
Q |
| |
|
||||||||||| |||| |||| || |||||||||||||||||||| |||||| || |||||||||||| |
|
|
| T |
47919478 |
tatgatgcagaaagatacatacaagtcaacaggatgttttgatcttacttgcaagggttttgtgcaaaca |
47919409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6886 times since January 2019
Visitors: 5772