View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0812_low_101 (Length: 341)
Name: NF0812_low_101
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0812_low_101 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 58 - 326
Target Start/End: Complemental strand, 35688899 - 35688633
Alignment:
| Q |
58 |
caataatcaacttcgaaatattaaacattgttcttcagtttttaattaacctttcagaattttattcttcattacccatctatctataaaacaacaagga |
157 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35688899 |
caataatcaacttcaaaatattaaacattgttctttagtttttaattaacctttcagaattttattcttcattacccatctatctataaaacaacaagga |
35688800 |
T |
|
| Q |
158 |
tnnnnnnnnnnnnnnnttcacatgcacggctttttcatttattttcaatttaaatatatcacacaacccgtatgcacaatattctcacttcagacaaatc |
257 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35688799 |
taaaaaaaaataat--ttcacatgcacggctttttcatttattttcaatttaaatatatcacacaacccgtatgcacaatgttctcacttcagacaaatc |
35688702 |
T |
|
| Q |
258 |
taaggacactttcataatcatacatgcatggccaatgattttttaccaaatcagatgcatcaactttgt |
326 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
35688701 |
taaggacactttcataatcatacatacatggccaatgatcttttaccaaatcagatgcaacaactttgt |
35688633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6185 times since January 2019
Visitors: 5762