View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0812_low_124 (Length: 306)

Name: NF0812_low_124
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0812_low_124
NF0812_low_124
[»] chr7 (1 HSPs)
chr7 (81-182)||(4520929-4521030)


Alignment Details
Target: chr7 (Bit Score: 86; Significance: 4e-41; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 81 - 182
Target Start/End: Complemental strand, 4521030 - 4520929
Alignment:
81 tggagggtgaaggagttgattcgtcatctcactcaattgttgcttattcttgatgtagatatttgagggacaagattttctcattaattcattagttttt 180  Q
    |||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||    
4521030 tggagggtgaaggagttgattcgtcatctctctcaattgtagcttattcttgatgtagatattcgagggacaagattttctgattaattcattagttttt 4520931  T
181 ct 182  Q
    ||    
4520930 ct 4520929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 5884 times since January 2019
Visitors: 5761