View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0812_low_126 (Length: 303)
Name: NF0812_low_126
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0812_low_126 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 273
Target Start/End: Original strand, 6313574 - 6313846
Alignment:
Q |
1 |
aacaatttttgttctttgtcatcaatcaatgtctcttataaaccaccacgttttcctttctttgtcatcaatctcttactaactccactaactaacataa |
100 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6313574 |
aacattttttgttctttgtcatcaatcaatgtctcttataaaccaccacgttttcctttctttgtcatcaatctcttactaactccactaactaacataa |
6313673 |
T |
 |
Q |
101 |
atcaatgttatgttagtgcgtgctcccttttttattcatgcattcacttcttatcctcaacaaccttaagctatgatctaatcttatatttattgcccag |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
T |
6313674 |
atcaatgttatgttagtgcgtgctcccttttttattcatgcattcacttcttatcctcaacaaccttaagctatgatctaatcttatatttattgcacag |
6313773 |
T |
 |
Q |
201 |
aggagttttttgttttcttaacattaacaacagactccaacaatggtttctactttgtctcacaaatgtctca |
273 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6313774 |
aggagttttttgttttcttaacattaacaacagactccaacaatggtttctactttgtctcacaaatgtctca |
6313846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University