View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0812_low_140 (Length: 284)
Name: NF0812_low_140
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0812_low_140 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 266
Target Start/End: Complemental strand, 6223761 - 6223496
Alignment:
| Q |
1 |
cttaccatttaaccactttgcatagttatggagatgccaaagcacaatcctgtttgctcaataaatgataaatccaccgatgaatataatcggtattttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6223761 |
cttaccatttaaccactttgcatagttatgcagatgccaaagcacaatcctgtttgctcaataaatgataaatccaccgatgaatatagtcggtattttt |
6223662 |
T |
|
| Q |
101 |
tcgcattcacgagttcgggacatcagttaccgctaagtcatgatcaaaagatcggaattcaagctcggttttttaatattaaaactnnnnnnnntgtatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6223661 |
tcgcattcacgagttcgggacatcagttaccgctaagttatgatcaaaagatcggaattcaagctcggttttttaatattaaaactaaaaaaaatgtatg |
6223562 |
T |
|
| Q |
201 |
tttttagaccatctaatgttgatcgaatggtgactaatgtaccaaatgcaggattccgtgtgatga |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6223561 |
tttttagaccatctaatgttgatcgaatggtgactaatgttccaaatgcaggattccgtgtgatga |
6223496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5558 times since January 2019
Visitors: 5757