View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0812_low_149 (Length: 270)
Name: NF0812_low_149
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0812_low_149 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 6e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 75 - 241
Target Start/End: Original strand, 18626185 - 18626351
Alignment:
| Q |
75 |
catgcggcagcatccacgtggtaagattctatgttatgtcagtgttgttttgtgtgattgagcttttggaagaccaaattaattagttagaaagaatatc |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18626185 |
catgcggcagcatccacgtggtaagattctatgttatgtcagtgttgttttgtgtgattgagcttttggaagaccaaattaattaattagaaagaatatc |
18626284 |
T |
 |
| Q |
175 |
aaattacaaaggtaaaatatgtgttttattttgtatggggatcatttataaacatcgtgtatattac |
241 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
18626285 |
aaattacgaaggtaaaatctgtgttttattttgtatggggatcatttataaacatcgtgcatattac |
18626351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 162 - 201
Target Start/End: Original strand, 2941408 - 2941447
Alignment:
| Q |
162 |
tagaaagaatatcaaattacaaaggtaaaatatgtgtttt |
201 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
2941408 |
tagaaagaatatcaaattacagagttaaaatatgtgtttt |
2941447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University