View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0812_low_150 (Length: 266)
Name: NF0812_low_150
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0812_low_150 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 49 - 266
Target Start/End: Original strand, 43089317 - 43089534
Alignment:
Q |
49 |
actcgttcctgttactctcattgtgattgtacctttcctgcaaaataaaaatcataagaaatgtaaatattcaagtgatactaggaattagaatatgaga |
148 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
43089317 |
actcgttcctgttactctcattgtgattatacctttcctgcaaaataacaatcataagaaatgtaaatattcaagtgatactaggaattaaaatatgaga |
43089416 |
T |
 |
Q |
149 |
tctgtttatgtattttaccgtggatcttctagcttgtgtttgaaatctgttatttgtttcattctttgtgtttatgatgagtccacgagatttatgagac |
248 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
43089417 |
tctgtttatgtattttaccgtggatcttctagcttgtgtttgaaatctgttatttgtttcattctttgtgcttatgatgagtccacgagatttatgagac |
43089516 |
T |
 |
Q |
249 |
cttactgttgcttgtgct |
266 |
Q |
|
|
|||||||||||||||||| |
|
|
T |
43089517 |
cttactgttgcttgtgct |
43089534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University