View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0812_low_151 (Length: 266)

Name: NF0812_low_151
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0812_low_151
NF0812_low_151
[»] chr7 (1 HSPs)
chr7 (173-239)||(31575349-31575414)


Alignment Details
Target: chr7 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 173 - 239
Target Start/End: Original strand, 31575349 - 31575414
Alignment:
173 catcactgcacacaaaaataaatcattgataataacatcttattactcacggcttctttatcgagaa 239  Q
    ||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||    
31575349 catcactgcacacaaaaataaatcattgataataa-atcttattagtcacggcttctttatcgagaa 31575414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 4736 times since January 2019
Visitors: 5752