View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0812_low_154 (Length: 265)
Name: NF0812_low_154
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0812_low_154 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 16 - 265
Target Start/End: Original strand, 6313294 - 6313543
Alignment:
Q |
16 |
aagcccatttatttattttataatcaaggtggtggttcttgatctgtcttcatcaacttgaatgaatattttatctaacagtcggtttcacttcactatc |
115 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6313294 |
aagcccatttatttattttataatcaaggtggtggttcttgatctgtcttcatcaacttgaatgaatattttatctaacagtcggtttcacttcactatc |
6313393 |
T |
 |
Q |
116 |
tgactactatattctttatnnnnnnntgaactagccactagtatagtaccacgtgtaccacaacaacaatttaaggttccaaaaatctaaatctgtctct |
215 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6313394 |
tgactactatattctttatgggggggtgaactagccactagtatagtaccacgtgtaccacaacaacaatttaaggttccaaaaatctaaatctgtctct |
6313493 |
T |
 |
Q |
216 |
tgtcacagaagtctaaccaatagccactgagctcacaaacacaatgccac |
265 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6313494 |
tgtcacagaagtctaaccaatagccactgagctcacaaacacaatgccac |
6313543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University