View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0812_low_156 (Length: 252)
Name: NF0812_low_156
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0812_low_156 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 8 - 243
Target Start/End: Original strand, 14471140 - 14471375
Alignment:
Q |
8 |
aatctgaagtgtaggtgttacatagcttagcattcaaaatttgctaaatggagataactctctggtttttaactagatattatatttaattaatatgaac |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
T |
14471140 |
aatctgaagtgtaggtgttacatagcttagcattcaaaatttgctaaatggaaataactctctggtttttaactagatattatattcaattaacatgaac |
14471239 |
T |
 |
Q |
108 |
aaacaatggagattttggccttaattatcatgttgcttgctgaaaagctcgtaaaattcagctgaagnnnnnnnngtagataatctgcccaaattacaaa |
207 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
14471240 |
aaacaatggagattttggccttaattatcatgttgcttgctgaaaagcttgtaaaattcagctgaagaaaaaaaggtagataatctgcccaaattacaaa |
14471339 |
T |
 |
Q |
208 |
tttttatcttttactattccctttttctgcctatga |
243 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||| |
|
|
T |
14471340 |
tttttatcttttaccattccctttttctgcctatga |
14471375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5018 times since January 2019
Visitors: 5753