View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0812_low_163 (Length: 251)
Name: NF0812_low_163
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0812_low_163 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 50101982 - 50102221
Alignment:
Q |
1 |
attacaaagtcgtttgattcatgtagctaattccaccagtgggattagacttggttgctgttgttgttgtaacaattaaatacattgtcgattcagattt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
50101982 |
attacaaagtcgtttgattcatgtagctaaacccaccagtgggattagacttggttgctgttgttgttgtaacaattaaatacattgtcgattcagattt |
50102081 |
T |
 |
Q |
101 |
cgatgagcttgatatgattaaagactatcaaaaatatatgttttatgattgctctgtctgtagtaaatggcctgggaaaaagcactggagggtaaccatt |
200 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
50102082 |
agatgagcttgatatgattaaagaccatcaaaaatatatgttttatgattgctctgtctgtagtaaatggcctgggaaaaagcactggagggtaaccatt |
50102181 |
T |
 |
Q |
201 |
actatgttgatctaattgtttcttgggttatgtttttcat |
240 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
T |
50102182 |
actatgttgatctaattgtttcttgggttatgtttttcat |
50102221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 38 - 71
Target Start/End: Original strand, 26299324 - 26299357
Alignment:
Q |
38 |
agtgggattagacttggttgctgttgttgttgta |
71 |
Q |
|
|
|||||||| ||||||||||||||||||||||||| |
|
|
T |
26299324 |
agtgggataagacttggttgctgttgttgttgta |
26299357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University