View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0812_low_169 (Length: 250)
Name: NF0812_low_169
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0812_low_169 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 8 - 239
Target Start/End: Original strand, 42705690 - 42705921
Alignment:
| Q |
8 |
cctagctgttgctgataaagtaagccactttgagggacatttatcaatacttaattactacnnnnnnnctacattataaacgtatgtagagttgagtgac |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || ||||||||||||||||||| |
|
|
| T |
42705690 |
cctagctgttgctgataaagtaagccactttgagggacatttatcaatacttaattactactttttttctacattatgaatgtatgtagagttgagtgac |
42705789 |
T |
|
| Q |
108 |
ttggcatttctgtgctgtcacatatgttgcttagcatttaggagttgggagcttggatatatggtcctatgtttgaactattttctccctttaaaacact |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42705790 |
ttggcatttctgtgctgtcacatatgttgcttagcatttaggagttgggagcttggatatatggtcctatgtttgaactattttctccctttaaaacact |
42705889 |
T |
|
| Q |
208 |
tcgttttttcaggttatcaagaacgatgacat |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42705890 |
tcgttttttcaggttatcaagaacgatgacat |
42705921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5209 times since January 2019
Visitors: 5755