View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0812_low_174 (Length: 241)
Name: NF0812_low_174
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0812_low_174 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 40010857 - 40010973
Alignment:
Q |
1 |
ttccacttggaaatgtttgattttaagaggataatcattttctctttcttttcgcatcaactatgttcaggaaatagaacgtcaagttcctttaatggat |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40010857 |
ttccacttggaaatgtttgattttaagaggataatcattttctctttcttttcgcctcgactatgttcaggaaatagaacgtcaagttcctttaatggat |
40010956 |
T |
 |
Q |
101 |
gaaatggacgcaaaggt |
117 |
Q |
|
|
||||||||||||||||| |
|
|
T |
40010957 |
gaaatggacgcaaaggt |
40010973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 144 - 233
Target Start/End: Original strand, 40010985 - 40011074
Alignment:
Q |
144 |
tcaatcttgctttttctatattggaataaataactttgcaaagtaatattgcaagtatgtaagtaaatacattacaaggtgctctgtgct |
233 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40010985 |
tcaatcttgctttttctatattggaataaataactttgcaaagtaatattgcaagtatgtaagtaaatacattacaaggtgctctgtgct |
40011074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University