View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0812_low_175 (Length: 240)
Name: NF0812_low_175
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0812_low_175 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 37 - 161
Target Start/End: Original strand, 43606437 - 43606560
Alignment:
Q |
37 |
atggttgataaaactatgtattatttcactcgaaatagtttatgtagttttattggttcaagtcaatttaaacctctaataattgctaattgaatcagaa |
136 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| |||||||||||||| ||||| |
|
|
T |
43606437 |
atggttgataaaactatgtattatttcactcgaaatagtttatgtagttttattggttcaagtcaatttaaa-ctttaacaattgctaattgaaacagaa |
43606535 |
T |
 |
Q |
137 |
cgagcccctaacttcctctaatatt |
161 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
43606536 |
cgagcccctaacttcctctaatatt |
43606560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University