View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0812_low_176 (Length: 239)

Name: NF0812_low_176
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0812_low_176
NF0812_low_176
[»] chr5 (1 HSPs)
chr5 (1-107)||(14848492-14848598)


Alignment Details
Target: chr5 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 107
Target Start/End: Original strand, 14848492 - 14848598
Alignment:
1 caatcaattagcattgatcattagtggattagtatgattctactaataaaattattttatcaatttctcttttactatctaataatcaatcatagcttga 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |    
14848492 caatcaattagcattgatcattagtggattagtatgattctactaataaaattattttatcaatttctcttttactatctaataatcaatcataacttca 14848591  T
101 ggcttca 107  Q
    |||||||    
14848592 ggcttca 14848598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University