View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0812_low_177 (Length: 238)
Name: NF0812_low_177
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0812_low_177 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 28635505 - 28635269
Alignment:
| Q |
1 |
cttgaagtttctcatcccaaaacttctcactgatttctgctccgatagcacaccacgcaccgtggttaaaagcagggatgcatcacatgactgcatacat |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||| |||||||||||| ||||||| ||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
28635505 |
cttgaaatttctcatcccaaaacttctcaccgatgtctgctccgataccacaccatgcaccgttgctaaaagcagggatgcatcacatgactgcatacat |
28635406 |
T |
|
| Q |
101 |
atgcatcattattagttgccgattaattt-aaacgatataactttgttgtgttaattatgtaatctatgtatatttatactcacattaactacgcaatca |
199 |
Q |
| |
|
|| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| ||||||||||||||| || ||| ||||||| |
|
|
| T |
28635405 |
atacatcattattagttgccgattaatttgaaacgatataactttgttgtgttaattatgttatctatatatatttatactcacgttgactgtgcaatca |
28635306 |
T |
|
| Q |
200 |
tggaagagatttcgaaaccatgatatggatgtgtttc |
236 |
Q |
| |
|
|||||||||||||||| ||| || |||| |||||||| |
|
|
| T |
28635305 |
tggaagagatttcgaacccaggaaatggctgtgtttc |
28635269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 28605337 - 28605243
Alignment:
| Q |
1 |
cttgaagtttctcatcccaaaacttctcactgatttctgctccgatagcacaccacgcaccgtggttaaaagcagggatgcatcacatgactgca |
95 |
Q |
| |
|
|||||||||||||||||||||||||||| | | | |||||||||||| ||| || ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28605337 |
cttgaagtttctcatcccaaaacttctctccgctgtctgctccgataccacgccgtgcaccgtctccaaaagcagggatgcatcacatgactgca |
28605243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 28654786 - 28654685
Alignment:
| Q |
1 |
cttgaagtttctcatcccaaaacttctcactgatttctgctccgatagcacaccacgcaccgtggttaaaagcagggatgcatcacatgactgcatacat |
100 |
Q |
| |
|
|||||| |||||||||||||||||||| || ||| |||||||||||| |||||| ||| ||| | |||||| | ||||||||| |||||||||||| || |
|
|
| T |
28654786 |
cttgaaatttctcatcccaaaacttcttaccgatgtctgctccgataccacaccgcgccacgttgctaaaagaaaggatgcatcgcatgactgcatatat |
28654687 |
T |
|
| Q |
101 |
at |
102 |
Q |
| |
|
|| |
|
|
| T |
28654686 |
at |
28654685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 169 - 212
Target Start/End: Complemental strand, 28604958 - 28604915
Alignment:
| Q |
169 |
tatatttatactcacattaactacgcaatcatggaagagatttc |
212 |
Q |
| |
|
||||||||||||||| || |||| |||||||||||||||||||| |
|
|
| T |
28604958 |
tatatttatactcaccttgactatgcaatcatggaagagatttc |
28604915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5632 times since January 2019
Visitors: 5758