View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0812_low_180 (Length: 235)
Name: NF0812_low_180
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0812_low_180 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 121
Target Start/End: Complemental strand, 39936259 - 39936139
Alignment:
| Q |
1 |
tatgaggaaagcagaataaaatatgtaaactcaaagaaatgtgcgtcaaaactaccaacccgctctgagagattatggacctcagcagcacgagatctct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39936259 |
tatgaggaaagcagaataaaatatgtaaactcaaacaaatgtgtgtcaaaactaccaacccgctctgagagattatggacctcagcagcacgagatctct |
39936160 |
T |
|
| Q |
101 |
ttgtagatgatccactgatat |
121 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
39936159 |
ttgtagatgatccactgatat |
39936139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 58 - 103
Target Start/End: Original strand, 29731844 - 29731889
Alignment:
| Q |
58 |
acccgctctgagagattatggacctcagcagcacgagatctctttg |
103 |
Q |
| |
|
|||| ||||||||||||||| ||||| |||||||| |||||||||| |
|
|
| T |
29731844 |
accctctctgagagattatgaacctctgcagcacgggatctctttg |
29731889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6524 times since January 2019
Visitors: 5768