View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0812_low_181 (Length: 231)
Name: NF0812_low_181
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0812_low_181 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 17 - 121
Target Start/End: Complemental strand, 21641103 - 21640999
Alignment:
| Q |
17 |
agtgatcatacgtacattaatgaatataggtttgttataagataaattataagagagaaaacaatcaatcaaagcctttgcttcttcagcaaaacaaggt |
116 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21641103 |
agtgatcatacgtacattaatgagtataggtttgttaaaagataaattataagagagaaaacaatcaatcaaagcctttgcttcttcagcaaaacaaggt |
21641004 |
T |
|
| Q |
117 |
tacac |
121 |
Q |
| |
|
||||| |
|
|
| T |
21641003 |
tacac |
21640999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4868 times since January 2019
Visitors: 5752