View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0812_low_182 (Length: 230)
Name: NF0812_low_182
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0812_low_182 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 21 - 122
Target Start/End: Complemental strand, 37167104 - 37167003
Alignment:
Q |
21 |
tgtctaaagccacacacaaccatctaccaattttccatagccacttaacatgaaaacatcaactactgctattgtgtccctctttattaccctcttcatc |
120 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
37167104 |
tgtctaaagccacacacaaccatctaccaattttccatagccaattaacatgaaaacatcaactaccactattgtgtccctctttattaccctcttcatc |
37167005 |
T |
 |
Q |
121 |
tc |
122 |
Q |
|
|
|| |
|
|
T |
37167004 |
tc |
37167003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University