View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0812_low_184 (Length: 225)
Name: NF0812_low_184
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0812_low_184 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 6 - 180
Target Start/End: Original strand, 22606419 - 22606593
Alignment:
Q |
6 |
atgtcgaataatatataaatgtgaagactcataaagctaatgccttaagatagcgagctctcatatagttttggattcctaaattatgatgacaattatc |
105 |
Q |
|
|
|||| ||| ||||||||||||||||||||| ||| ||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
22606419 |
atgtggaacaatatataaatgtgaagactcgtaaggctaatgccttaagataatgagctctcatatagttttggattcgtaaattatgatgacaattatc |
22606518 |
T |
 |
Q |
106 |
taatatttaaatagatggaagcaataaatggattaaatttggaagtttataaccaaagtttgataattgtttaaa |
180 |
Q |
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22606519 |
tgatatttaaatagatggaagcaataaatggattaaatttggaagtttataaccaaagtttgataattgtttaaa |
22606593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University