View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0812_low_185 (Length: 224)
Name: NF0812_low_185
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0812_low_185 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 5 - 179
Target Start/End: Original strand, 22606419 - 22606593
Alignment:
| Q |
5 |
atgtcgaagaatatataaatgtgaagactcataaagctaatgccttaagatagcgagctctcatatagttttggattcctaaattatgatgacaattatc |
104 |
Q |
| |
|
|||| ||| ||||||||||||||||||||| ||| ||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22606419 |
atgtggaacaatatataaatgtgaagactcgtaaggctaatgccttaagataatgagctctcatatagttttggattcgtaaattatgatgacaattatc |
22606518 |
T |
 |
| Q |
105 |
taatatttaaatagatggaagcaataaatggattaaatttggaagtttataaccaaagtttgataattgtttaaa |
179 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22606519 |
tgatatttaaatagatggaagcaataaatggattaaatttggaagtttataaccaaagtttgataattgtttaaa |
22606593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University