View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0812_low_191 (Length: 204)
Name: NF0812_low_191
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0812_low_191 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 73; Significance: 1e-33; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 1e-33
Query Start/End: Original strand, 2 - 74
Target Start/End: Original strand, 22606521 - 22606593
Alignment:
| Q |
2 |
atatttaaatagatggaagcaataaatggattaaatttggaagtttataaccaaagtttgataattgtttaaa |
74 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22606521 |
atatttaaatagatggaagcaataaatggattaaatttggaagtttataaccaaagtttgataattgtttaaa |
22606593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4754 times since January 2019
Visitors: 5752