View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0812_low_62 (Length: 432)
Name: NF0812_low_62
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0812_low_62 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 15 - 336
Target Start/End: Original strand, 40893313 - 40893634
Alignment:
Q |
15 |
tattaaaaactccttcaaagttaactccattaatcattttaatccaaaaggtttaacatcagttaagtgtgatgatttgtcttgtaactttgctgatgtg |
114 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |||| ||| |
|
|
T |
40893313 |
tattaaaaactccttcaaagttaactccattaatcattttaatccaaaaggttaaatatcagttaagtgtgatgatttgtcttgtaactttactgacgtg |
40893412 |
T |
 |
Q |
115 |
gcatctgactataaatattataatgattgattggatttttcctttgacaacttggcttttattttaattgacatttatttagaaaataaaatatcataaa |
214 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40893413 |
gcatctgactagaaatattataatgattgattggatttttcctttgacaacttggcttttattttaattgacatttatttagaaaataaaatatcataaa |
40893512 |
T |
 |
Q |
215 |
acatcaaaaattcataagttctaggtaacttattaaacccagaatcaaaactcaaaagtcaacactatcttctcaaataacctaaatcttcacaacctct |
314 |
Q |
|
|
|||||||||||||||||||| |||||||| ||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
40893513 |
acatcaaaaattcataagttataggtaacctattaaacccaaaatcaaaactcaaaagtcaccactatcttctcaaataacctaaatcttcacaacctct |
40893612 |
T |
 |
Q |
315 |
caaatgtagaatccatgacttt |
336 |
Q |
|
|
|||| |||||||||||||||| |
|
|
T |
40893613 |
caaacatagaatccatgacttt |
40893634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5917 times since January 2019
Visitors: 5761