View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0812_low_64 (Length: 427)
Name: NF0812_low_64
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0812_low_64 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 3e-89; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 3e-89
Query Start/End: Original strand, 59 - 241
Target Start/End: Original strand, 56658 - 56840
Alignment:
| Q |
59 |
attaatggaattatagtattaaatgctacataaagggcttaagtgtctttttagaggagacttaaatcacaagttttgaacatgtcagttaaacaaacat |
158 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
56658 |
attaatggaattatactattaaatgctacataaagggcataagtgtctttttagaggagactttaatcacaagttttgaacatttcagttaaacaaacat |
56757 |
T |
|
| Q |
159 |
ttaccaacaactctgaacgtttcttctgcttcttgagaaaaaagctgatgaaaatggatcacttaggtataagattcagaatg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56758 |
ttaccaacaactctgaacgtttcttctgcttcttgagaaaaaagctgatgaaaatggatcacttaggtataagattcagaatg |
56840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 111; E-Value: 7e-56
Query Start/End: Original strand, 304 - 414
Target Start/End: Original strand, 56901 - 57011
Alignment:
| Q |
304 |
ggtataagattcatgaatggctacagagaccaaaacaagtattgtgaagctcaaatcaaatgatccagatgaatctttcaatggaaagaatgatcctttg |
403 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56901 |
ggtataagattcatgaatggctacagagaccaaaacaagtattgtgaagctcaaatcaaatgatccagatgaatctttcaatggaaagaatgatcctttg |
57000 |
T |
|
| Q |
404 |
attgttaagaa |
414 |
Q |
| |
|
||||||||||| |
|
|
| T |
57001 |
attgttaagaa |
57011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 56564 - 56603
Alignment:
| Q |
1 |
atataacatacgaaaacgttttgatcattttaactagatt |
40 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
56564 |
atataacatacgaaaacattttgatcattttaactagatt |
56603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6478 times since January 2019
Visitors: 5768