View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0812_low_72 (Length: 400)
Name: NF0812_low_72
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0812_low_72 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 321; Significance: 0; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 50 - 382
Target Start/End: Original strand, 28381985 - 28382317
Alignment:
Q |
50 |
accagcaccagcaacagcaacattatacatttctgaagtaaaggatgactgaaccgaaaccggttcaggtacctgaaccgaacaggaacaatatgaaccg |
149 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28381985 |
accagcaccagcaacagcaacattatacatttctgaagcaaaggatgactgaaccgaaaccggttcaggtacctgaaccgaacaggaacaatatgaaccg |
28382084 |
T |
 |
Q |
150 |
ggttgaactttttgaaccggatcctcagcagaaggttcactagtaactaacggaatcactctttccgcgttttcttcagaggaaacatcaacaccaccgt |
249 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28382085 |
ggttgaacttcttgaaccggatcctcagcagaaggttcactagtaactaacggaatcactctttccgcgttttcttcagaggaaacatcaacaccaccgt |
28382184 |
T |
 |
Q |
250 |
tatttccaccgttttctccgtcaaatttcgcttgctgttcagcattaccgttaattccgtcgttttctccgttaactttcactttcttttcatcatcatt |
349 |
Q |
|
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28382185 |
tatttccaccgttttctccgtcaaatttcacttgctgttcagcattaccgttaattccgtcgttttctccgttaactttcactttcttttcatcatcatt |
28382284 |
T |
 |
Q |
350 |
cacagtttccaccatctgaatttcctgaatctc |
382 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
28382285 |
cacagtttccaccatctgaatttcctgaatctc |
28382317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 310 - 381
Target Start/End: Complemental strand, 28341532 - 28341464
Alignment:
Q |
310 |
cgttttctccgttaactttcactttcttttcatcatcattcacagtttccaccatctgaatttcctgaatct |
381 |
Q |
|
|
|||||||||||| ||||||||||| || |||||| ||| ||||| ||||||| |||||||||||||||||| |
|
|
T |
28341532 |
cgttttctccgtcaactttcacttcctgttcatc--cat-cacagattccaccttctgaatttcctgaatct |
28341464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5225 times since January 2019
Visitors: 5755