View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0812_low_74 (Length: 394)
Name: NF0812_low_74
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0812_low_74 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 87 - 349
Target Start/End: Original strand, 6223738 - 6224004
Alignment:
| Q |
87 |
tatgcaaagtggttaaatggtaagggtaatgcttggagattctatcatgaatcggaggctgttgataattatgagcgaaattgggattttaaaggtggac |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6223738 |
tatgcaaagtggttaaatggtaagggtaatgcttggagattctatcatgaatcggaggctgttgataattatgagcgaaattgggattttaaaggtggac |
6223837 |
T |
|
| Q |
187 |
tgtagaagagtactgcaaagtctgatgaaggttattggtgttcaaggaaaattattcattgaaaattc----taaggttatataactaaaatatcaccac |
282 |
Q |
| |
|
| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
6223838 |
tatggaagagtactgcaaagtctgatgaaggttattggtgttcaaggaaaattattcattgaaaattctaattaaggctatataactaaaatatcaccac |
6223937 |
T |
|
| Q |
283 |
agaggtgtatttgtaattttgtatcaataatctagcttattttaatgttttgaatttggcagctata |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6223938 |
agaggtgtatttgtaattttgtatcaataatgtagcttattttaatgttttgaatttggcagctata |
6224004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4810 times since January 2019
Visitors: 5752