View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0812_low_84 (Length: 371)
Name: NF0812_low_84
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0812_low_84 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 129; Significance: 1e-66; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 190 - 342
Target Start/End: Original strand, 14353186 - 14353338
Alignment:
| Q |
190 |
aatctagcaatgtctgtataatttcttgattcaatgtgttcgataattcattaatagaatttcagctattttttcaatatannnnnnnngttgagattgt |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
14353186 |
aatctagcaatgtctgtataatttcttgattcaatgtgttcgataattcattaatagaatttcagctattttttcaatatattttttttgttgagattgt |
14353285 |
T |
 |
| Q |
290 |
tttagacttatctagttaaacatctatgactttcgacatatcaatattatata |
342 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14353286 |
tttagacttatctagttaaacatctatgactttcgacatatcaatattatata |
14353338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 13 - 111
Target Start/End: Original strand, 14353009 - 14353107
Alignment:
| Q |
13 |
aatatcatttagaatgaaagaatttaaatttgtatccctaaagatacatttaaatttccatacatagacaattgaattgttttttgaaagaacatagac |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
14353009 |
aatatcatttagaatgaaagaatttaaatttgtatccctaaagatacatttaaatttccatacatagacaattgaattgttttttgagagaacatagac |
14353107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 13 - 53
Target Start/End: Complemental strand, 43886165 - 43886125
Alignment:
| Q |
13 |
aatatcatttagaatgaaagaatttaaatttgtatccctaa |
53 |
Q |
| |
|
||||||||| | ||||||| ||||||||||||||||||||| |
|
|
| T |
43886165 |
aatatcattcacaatgaaataatttaaatttgtatccctaa |
43886125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University