View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0812_low_87 (Length: 364)
Name: NF0812_low_87
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0812_low_87 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 1e-78; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 108 - 276
Target Start/End: Complemental strand, 37035174 - 37035006
Alignment:
Q |
108 |
tttatgattctaaaaaaccaaagtaatgtcaagggaatatttgttttcaaaaggaaaaaatgtttaatcatttaggaacattcccgatgtagagaaaaac |
207 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
37035174 |
tttatgattctaagaaaccaaagtaatgtcaagggaatatttgtttttaaaaggaaaaaatgtttaatcatttaggaacattcccggtgtagagaaaaac |
37035075 |
T |
 |
Q |
208 |
aatgttgagtctcgtaaggcctagtataaccaaccgataataccaatatcgttaggttggatatcctct |
276 |
Q |
|
|
|||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37035074 |
aatgttgagtttcgtaaggcctaatataaccaaccgataataccaatatcgttaggttggatatcctct |
37035006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University