View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0813_high_9 (Length: 356)
Name: NF0813_high_9
Description: NF0813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0813_high_9 |
 |  |
|
[»] scaffold0012 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 78; Significance: 3e-36; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 98 - 320
Target Start/End: Complemental strand, 17826310 - 17826093
Alignment:
Q |
98 |
ctatctataatattttgaggtagcaatcctttgctgcacctcttttttggtttnnnnnnnnnnnnngtcttagatgtctcaccaaagataannnnnnnnn |
197 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |||||||| ||||||||| |
|
|
T |
17826310 |
ctatctataatattttgaggtagcagtcctttgctgcacctcttttttggtt----aaaaataaaagtcttgaatgtctcaacaaagataa--ttttttt |
17826217 |
T |
 |
Q |
198 |
ngttttagttacataacaaagatttctta-nnnnnnnnaaagagttgtcgtcaaacaaagattaaatgaattgaatttattgtcaattgaaaaataaatg |
296 |
Q |
|
|
||||| ||||||| |||||||||||||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
17826216 |
tgttttcgttacatgacaaagatttcttatttgtttttaaagaattgtcttcaaacaaagattaaatgaattgaatttattgtcaattgaaaaataaatg |
17826117 |
T |
 |
Q |
297 |
ttaaatgaaatcaattatgatgat |
320 |
Q |
|
|
|||||||||||||||||||||||| |
|
|
T |
17826116 |
ttaaatgaaatcaattatgatgat |
17826093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 17826407 - 17826374
Alignment:
Q |
1 |
gcttttatggtcaagatagacttgggttacccaa |
34 |
Q |
|
|
|||||||| ||||||||||||||||||||||||| |
|
|
T |
17826407 |
gcttttatcgtcaagatagacttgggttacccaa |
17826374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 47; Significance: 9e-18; HSPs: 6)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 94 - 148
Target Start/End: Complemental strand, 23921205 - 23921151
Alignment:
Q |
94 |
ctctctatctataatattttgaggtagcaatcctttgctgcacctcttttttggt |
148 |
Q |
|
|
||||||||||||||||||||||||||||| |||||||||||||||| |||||||| |
|
|
T |
23921205 |
ctctctatctataatattttgaggtagcagtcctttgctgcacctcctttttggt |
23921151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 103 - 149
Target Start/End: Complemental strand, 12590961 - 12590915
Alignment:
Q |
103 |
tataatattttgaggtagcaatcctttgctgcacctcttttttggtt |
149 |
Q |
|
|
||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
12590961 |
tataaaattttgaggtagcagtcctttgctgcacctcttttttggtt |
12590915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 23921298 - 23921265
Alignment:
Q |
1 |
gcttttatggtcaagatagacttgggttacccaa |
34 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
23921298 |
gcttttatggtcaagatagacttgggttacccaa |
23921265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 109 - 149
Target Start/End: Complemental strand, 13600109 - 13600069
Alignment:
Q |
109 |
attttgaggtagcaatcctttgctgcacctcttttttggtt |
149 |
Q |
|
|
|||||||||||||| |||| ||||||||||||||||||||| |
|
|
T |
13600109 |
attttgaggtagcagtcctctgctgcacctcttttttggtt |
13600069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 250 - 317
Target Start/End: Original strand, 35823267 - 35823334
Alignment:
Q |
250 |
aacaaagattaaatgaattgaatttattgtcaattgaaaaataaatgttaaatgaaatcaattatgat |
317 |
Q |
|
|
|||||||||||||| ||||| |||||| || || |||||||||||||||||| |||| |||||||| |
|
|
T |
35823267 |
aacaaagattaaatcaattgtctttattatcgatagaaaaataaatgttaaataaaattgattatgat |
35823334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 103 - 141
Target Start/End: Complemental strand, 12590807 - 12590769
Alignment:
Q |
103 |
tataatattttgaggtagcaatcctttgctgcacctctt |
141 |
Q |
|
|
||||| |||||||||||||| |||||||||||||||||| |
|
|
T |
12590807 |
tataaaattttgaggtagcactcctttgctgcacctctt |
12590769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 5e-16; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 250 - 317
Target Start/End: Complemental strand, 47442754 - 47442687
Alignment:
Q |
250 |
aacaaagattaaatgaattgaatttattgtcaattgaaaaataaatgttaaatgaaatcaattatgat |
317 |
Q |
|
|
||||||||| |||||||||| ||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
T |
47442754 |
aacaaagatgaaatgaattgtctttattgtcaattgaaaaataaatgttcaatgaaattgattatgat |
47442687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 103 - 149
Target Start/End: Complemental strand, 577049 - 577003
Alignment:
Q |
103 |
tataatattttgaggtagcaatcctttgctgcacctcttttttggtt |
149 |
Q |
|
|
||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
577049 |
tataaaattttgaggtagcagtcctttgctgcacctcttttttggtt |
577003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 103 - 149
Target Start/End: Original strand, 17736452 - 17736498
Alignment:
Q |
103 |
tataatattttgaggtagcaatcctttgctgcacctcttttttggtt |
149 |
Q |
|
|
||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
17736452 |
tataaaattttgaggtagcagtcctttgctgcacctcttttttggtt |
17736498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 103 - 149
Target Start/End: Complemental strand, 35710489 - 35710443
Alignment:
Q |
103 |
tataatattttgaggtagcaatcctttgctgcacctcttttttggtt |
149 |
Q |
|
|
||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
35710489 |
tataaaattttgaggtagcagtcctttgctgcacctcttttttggtt |
35710443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 103 - 149
Target Start/End: Complemental strand, 35714797 - 35714751
Alignment:
Q |
103 |
tataatattttgaggtagcaatcctttgctgcacctcttttttggtt |
149 |
Q |
|
|
||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
35714797 |
tataaaattttgaggtagcagtcctttgctgcacctcttttttggtt |
35714751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 103 - 141
Target Start/End: Complemental strand, 35714644 - 35714606
Alignment:
Q |
103 |
tataatattttgaggtagcaatcctttgctgcacctctt |
141 |
Q |
|
|
||||| |||||||||||||| |||||||||||||||||| |
|
|
T |
35714644 |
tataaaattttgaggtagcactcctttgctgcacctctt |
35714606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 103 - 149
Target Start/End: Original strand, 3793077 - 3793123
Alignment:
Q |
103 |
tataatattttgaggtagcaatcctttgctgcacctcttttttggtt |
149 |
Q |
|
|
||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
3793077 |
tataaaattttgaggtagcagtcctttgctgcacctcttttttggtt |
3793123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 109 - 149
Target Start/End: Complemental strand, 29682604 - 29682564
Alignment:
Q |
109 |
attttgaggtagcaatcctttgctgcacctcttttttggtt |
149 |
Q |
|
|
|||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
29682604 |
attttgaggtagcagtcctttgctgcacctcttttttggtt |
29682564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 254 - 307
Target Start/End: Complemental strand, 8145655 - 8145602
Alignment:
Q |
254 |
aagattaaatgaattgaatttattgtcaattgaaaaataaatgttaaatgaaat |
307 |
Q |
|
|
|||||||||||||||| |||| |||| |||||||||||||| ||||||||||| |
|
|
T |
8145655 |
aagattaaatgaattgtctttagtgtcgattgaaaaataaatattaaatgaaat |
8145602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 279 - 317
Target Start/End: Original strand, 25171841 - 25171879
Alignment:
Q |
279 |
tcaattgaaaaataaatgttaaatgaaatcaattatgat |
317 |
Q |
|
|
|||||||||||| ||||||||||||||||| |||||||| |
|
|
T |
25171841 |
tcaattgaaaaagaaatgttaaatgaaatccattatgat |
25171879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 103 - 149
Target Start/End: Original strand, 22475241 - 22475287
Alignment:
Q |
103 |
tataatattttgaggtagcaatcctttgctgcacctcttttttggtt |
149 |
Q |
|
|
||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
22475241 |
tataaaattttgaggtagcagtcctttgctgcacctcttttttggtt |
22475287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 103 - 149
Target Start/End: Complemental strand, 11954026 - 11953980
Alignment:
Q |
103 |
tataatattttgaggtagcaatcctttgctgcacctcttttttggtt |
149 |
Q |
|
|
||||| |||||||||||| | |||||||||||||||||||||||||| |
|
|
T |
11954026 |
tataaaattttgaggtaggagtcctttgctgcacctcttttttggtt |
11953980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 103 - 141
Target Start/End: Original strand, 22475393 - 22475431
Alignment:
Q |
103 |
tataatattttgaggtagcaatcctttgctgcacctctt |
141 |
Q |
|
|
||||| |||||||||||||| |||||||||||||||||| |
|
|
T |
22475393 |
tataaaattttgaggtagcactcctttgctgcacctctt |
22475431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 103 - 149
Target Start/End: Complemental strand, 9919417 - 9919371
Alignment:
Q |
103 |
tataatattttgaggtagcaatcctttgctgcacctcttttttggtt |
149 |
Q |
|
|
||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
9919417 |
tataaaattttgaggtagcagtcctttgctgcacctcttttttggtt |
9919371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 103 - 141
Target Start/End: Complemental strand, 9919264 - 9919226
Alignment:
Q |
103 |
tataatattttgaggtagcaatcctttgctgcacctctt |
141 |
Q |
|
|
||||| |||||||||||||| |||||||||||||||||| |
|
|
T |
9919264 |
tataaaattttgaggtagcactcctttgctgcacctctt |
9919226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 103 - 149
Target Start/End: Complemental strand, 29843371 - 29843325
Alignment:
Q |
103 |
tataatattttgaggtagcaatcctttgctgcacctcttttttggtt |
149 |
Q |
|
|
||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
29843371 |
tataaaattttgaggtagcagtcctttgctgcacctcttttttggtt |
29843325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 103 - 149
Target Start/End: Original strand, 42679971 - 42680017
Alignment:
Q |
103 |
tataatattttgaggtagcaatcctttgctgcacctcttttttggtt |
149 |
Q |
|
|
||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
42679971 |
tataaaattttgaggtagcagtcctttgctgcacctcttttttggtt |
42680017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 103 - 141
Target Start/End: Original strand, 42680125 - 42680163
Alignment:
Q |
103 |
tataatattttgaggtagcaatcctttgctgcacctctt |
141 |
Q |
|
|
||||| |||||||||||||| |||||||||||||||||| |
|
|
T |
42680125 |
tataaaattttgaggtagcactcctttgctgcacctctt |
42680163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0012 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0012
Description:
Target: scaffold0012; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 253 - 307
Target Start/End: Original strand, 178088 - 178142
Alignment:
Q |
253 |
aaagattaaatgaattgaatttattgtcaattgaaaaataaatgttaaatgaaat |
307 |
Q |
|
|
||||||||||| ||||| ||||||||||||| |||||||||| |||||| |||| |
|
|
T |
178088 |
aaagattaaattgattgactttattgtcaattaaaaaataaatattaaataaaat |
178142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5026 times since January 2019
Visitors: 5753