View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0813_low_14 (Length: 298)
Name: NF0813_low_14
Description: NF0813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0813_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 36 - 269
Target Start/End: Original strand, 784438 - 784672
Alignment:
| Q |
36 |
gaacctgtgaataaaatattaatcaaatttaattattttgatatttttg-tttacatgtttttggtacaaaatttcatgtgattagtgatgtctaaactt |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
784438 |
gaacctgtgaataaaatattaatcaaatttaattattttgatatttttggtttacatgttattggtacaaaatttcatgtgattagtgatgtctaaactt |
784537 |
T |
 |
| Q |
135 |
cattgaaaaatttatgagacataacgtagattttttcatttcaacannnnnnnncgtacgcaagattcatcttagttagcatttgaataacttgaatcca |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
784538 |
cattgaaaaatttatgagacataacgtagatttttccatttcaacattttttttcgtacgcaagattcatcttaattagcatttgaataacttgaatcca |
784637 |
T |
 |
| Q |
235 |
tgttttaaaaattggatcgaatatattgattcaac |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
784638 |
tgttttaaaaattggatcgaatatattgattcaac |
784672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University