View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0813_low_15 (Length: 276)
Name: NF0813_low_15
Description: NF0813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0813_low_15 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 26 - 276
Target Start/End: Original strand, 8793217 - 8793462
Alignment:
| Q |
26 |
atcaccatgatatgaaatatgaatataatacatgtaacttattagatgaacaacttttgacttgtgtactatctatctgtgagcatgaagtcatgcaagt |
125 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8793217 |
atcaccatgatatgaaatatgaatacaa-acatgtaacttattagatgaacaacttttgacttgtgtactat----ctgtgagcatgaagtcatgcaagt |
8793311 |
T |
 |
| Q |
126 |
tgtcaaaataattgaacatatgatagatattattgatactgttttgttatccaaaatatgagattggcccttggtactacaagtttgtcttataccttgg |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
8793312 |
tgtcaaaataattgaacatatgatagatattattgatactgttttgttatccaaaatatgagattggcccttggtactacaagtttgtcttataccttag |
8793411 |
T |
 |
| Q |
226 |
gttttagatgtggcaagtgacgctactacttttccttacggaaaacataat |
276 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8793412 |
gttttagatgtggcaagtgacgctaccacttttccttacggaaaacataat |
8793462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University