View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0813_low_17 (Length: 258)
Name: NF0813_low_17
Description: NF0813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0813_low_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 28737981 - 28738208
Alignment:
Q |
1 |
tgagggctatgaccaaacaagcagccaggtgaattctctttacactcaacctatccttgttgattgattatgaatgagtgaggactcattgcttctgact |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28737981 |
tgagggctatgaccaaacaagcagccaggtgaattctctttacactcaacctatccttgttgattgattatgaatgagtgaggactcattgcttctgact |
28738080 |
T |
 |
Q |
101 |
tctttattgagttttttgttgctacctaagaggacaaatagaaatttgactgaaccattgattcttctttataaaatatgccctagtttttggtttttcc |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
T |
28738081 |
tctttattgagttttttgttgctacctaagaggacaaatagaaatttgactgaaccattgattcttctttataaaatatggcctagtttatggtttttcc |
28738180 |
T |
 |
Q |
201 |
tcatgtagaatcttcactttaaatttga |
228 |
Q |
|
|
|||||||||||||||| ||||| ||||| |
|
|
T |
28738181 |
tcatgtagaatcttcaatttaattttga |
28738208 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University