View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0813_low_22 (Length: 247)
Name: NF0813_low_22
Description: NF0813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0813_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 7 - 117
Target Start/End: Original strand, 18421095 - 18421205
Alignment:
Q |
7 |
ggaagaactggattatttgatcttgaaaagcacttcgctttcaatggatcatatcacagaaacccaattaacatagcaattcatgttttattcgtttggc |
106 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18421095 |
ggaagaactggattatttgatcttgaaaagcacttcgctttctatggatcatatcacagaaacccaattaacatagcaattcatgttttattcgtttggc |
18421194 |
T |
 |
Q |
107 |
caatattcttc |
117 |
Q |
|
|
|||| |||||| |
|
|
T |
18421195 |
caattttcttc |
18421205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4992 times since January 2019
Visitors: 5753