View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0813_low_27 (Length: 217)
Name: NF0813_low_27
Description: NF0813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0813_low_27 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 3542525 - 3542309
Alignment:
| Q |
1 |
aaaaaacgagtatcgaaaatactttgacgagttatccgtaaatattatcggtagacggtagtttaattggtgttcattgaatatttatcattgttctaat |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||||||||||| ||||||||||| || | || ||||| ||||||||||||| ||||||||||| |
|
|
| T |
3542525 |
aaaaaacgagtgtcgaaaatactttgacgagttaatcgtaaatattattggtagacggtaattcagttagtgttaattgaatatttatgattgttctaat |
3542426 |
T |
|
| Q |
101 |
tttgacgagtctctgaaactcgacgctggatggttattaaaaagaaaatagaatgagagagaatttgagtaggagtaaaattaggagagtggagtgagct |
200 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3542425 |
tttgatgagtctctgaaacttgacgctggatggttattaaaaagaaaatagaatgagagagaatttgagtaggagtaaaattaggagagtggagtgagct |
3542326 |
T |
|
| Q |
201 |
aaaataggagaaatagt |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
3542325 |
aaaataggagaaatagt |
3542309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5039 times since January 2019
Visitors: 5753