View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0813_low_9 (Length: 368)
Name: NF0813_low_9
Description: NF0813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0813_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 8 - 340
Target Start/End: Complemental strand, 43498122 - 43497785
Alignment:
Q |
8 |
tgagatgaagaagaagaagaggctttcttggaaaaccttcttaccgagtttttggttgttgtgtcaagtggggggttgcgtgaagaacattggattgaag |
107 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43498122 |
tgagatgaagaagaagaagaggttttcttggaaaaccttcttaccgagtttttggttgctgtgtcaagtggggggttgcgtgaagaacattggattgaag |
43498023 |
T |
 |
Q |
108 |
gttgttttcttgggttgaaattgatggtggtgattgaagggaaggattcataaccaaaatttgagagtgcaaaaagcttgggtatgagagaatgagagaa |
207 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43498022 |
gttgttttcttgggttgaaattgatggtggtgattgaagggaaggattcataaccaaaatttgagagtgcaaaaagcttgggtatgagagaatgagagaa |
43497923 |
T |
 |
Q |
208 |
agaaagagattgttgcagtt------gcagcgtgaggggagaagtagccattacatttgccttatcatatgtggctgctaacaagtactaacacccaaat |
301 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
T |
43497922 |
agaaagagattgttgcagttgcagttgcagcgtgaggggagaagtagccattacatttgccttatcatatgtggctgctaacaagtactaacaccc-aat |
43497824 |
T |
 |
Q |
302 |
ctaatcttcatgtacatgttttttcgtgtacttgtaagt |
340 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
43497823 |
ctaatcttcatatacatgttttttcgtgtacttgtaagt |
43497785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University