View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0814-Insertion-3 (Length: 359)
Name: NF0814-Insertion-3
Description: NF0814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0814-Insertion-3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 4e-54; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 197 - 312
Target Start/End: Complemental strand, 46304326 - 46304211
Alignment:
| Q |
197 |
tttgaaggagctttgcccgctgcagtcgaatctcacaaatgcaaatgggtaacgcagatacaattctttctgctttcctattcgattaaaatgcaagctc |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46304326 |
tttgaaggagctttgcccgctgcagtcgaatctcacaaatgcaaatgggtaactcagatacaattctttctgctttcctattcgattaaaatgcaagctc |
46304227 |
T |
|
| Q |
297 |
ttgttcgagtgttaat |
312 |
Q |
| |
|
||||| |||||||||| |
|
|
| T |
46304226 |
ttgtttgagtgttaat |
46304211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 12 - 86
Target Start/End: Complemental strand, 46304551 - 46304477
Alignment:
| Q |
12 |
gaagggttgctgatattcactctcctatctctcccgatcacgtttctggttagtctctttctttctggattaggg |
86 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46304551 |
gaagggttgctgatattcactcacctatctctcccgatcacgtttctggttagtctctttctttctggattaggg |
46304477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 197 - 249
Target Start/End: Original strand, 46027476 - 46027528
Alignment:
| Q |
197 |
tttgaaggagctttgcccgctgcagtcgaatctcacaaatgcaaatgggtaac |
249 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
46027476 |
tttgaaggagctttgccggctgcagtcgaatctcacaagtgcaaatgggtaac |
46027528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 157 - 200
Target Start/End: Original strand, 46027392 - 46027435
Alignment:
| Q |
157 |
tatattgttatcaaattttgggggattagtgtttaaaacttttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46027392 |
tatattgttatcaaattttgggggattagtgtttaaaacttttg |
46027435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 46304410 - 46304365
Alignment:
| Q |
157 |
tatattgttatcaaattttgggggattagtgtttaaaacttttgaa |
202 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
46304410 |
tatattgttatcaaatttttggggattagtgtttaaaacctttgaa |
46304365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University