View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0814_high_14 (Length: 439)
Name: NF0814_high_14
Description: NF0814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0814_high_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 336; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 1 - 344
Target Start/End: Complemental strand, 35037418 - 35037075
Alignment:
| Q |
1 |
cttccttttttacccttagcagagcaagtataaccaaaatggccacgacccacttcttgtccaagctcaaaattcgtcacaaaatgcttagaaaatccaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35037418 |
cttccttttttacccttagcagagcaagtataaccaaaatggccacgacccacttcttgtccaagctcaaaattcgtcacaaaatgcttagaaaatccaa |
35037319 |
T |
|
| Q |
101 |
aactcttatccaacccaacttcacactcactcccttcaggtatagtagcttcattaggcttcacagagccatgtcttctagctagcagtgctcgaatgtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35037318 |
aactcttatccaacccaacttcacactcactcccttcaggtatagtagcttcattaggcttcacagagccgtgtcttctagctagcagtgctcgaatgtg |
35037219 |
T |
|
| Q |
201 |
ctttgccggtgacggcggaggaaagggtcgcttgaagatccgaagaggggttcgcagaggggttgaatttgaactcacagttgaatttgcaggtgaattt |
300 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35037218 |
ctttgccggtgaaggcggaggaaagggtcgcttgaagatccgaagaggggttcgcagaggggttgaatttgaactcacagttgaatttgcaggtgaattt |
35037119 |
T |
|
| Q |
301 |
ttgaagaaacttggtaatggacttggactaaaaaatggaaactt |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35037118 |
ttgaagaaacttggtaatggacttggactaaaaaatggaaactt |
35037075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University